Have a Nice Day

Personal Hygienic is the main moto in front of Infectious Diseases & Antibiotic Resistance Awareness - Dr.PNR


visit Dr.PNR home by clicking
http://pnramesh.blogspot.com/,http://www.epernicus.com/ http://www.greenyheavenfarmhouse.weebly.com/
https://www.researchgate.net/profile/Ramesh_Nachimuthu/publications
https://scholar.google.co.in/citations?user=Db50MsoAAAAJ&hl=en

Thanks for visiting my home.......

Come again and see more and new

updates.......


Know more about Antibiotic Resistance - http://save-antibiotics.blogspot.com/
Antibiotic Awareness day November 18th

World Health day April 7th


Education Loan Task Force - http://www.eltf.in/
http://educationeagle.blogspot.com/ - Vacancy announcements in India
BioMedical Research Felloeship Programme for India -
http://www.wellcomedbt.org/
Online News Paper from Around the world -
http://newspapermap.com

PhD @ EMBO
- http://www.embo.org/programmes/yip/vacancies.html

Intellectual Development Foundation-Theory of Shivashanmugam

http://wikia.academia.edu/SivashanmugamPalaniappan/Papers/1236851/The_Expected_Knowledge Farmers Bio Fertilizers-http://www.farmersbiofertilizers.com

World Health Day 2011 web button

Tuesday, July 19, 2016

Rapid communication
Following the report of of mcr-1 detection in China in November 2015 [1], we screened 105 colistin-resistant Escherichia coli (colistin minimum inhibitory concentration (MIC) 4–8 mg/L [2]) isolated during 2011–12 from passive surveillance of diarrhoea in 52 calves and 53 piglets in Belgium [3]. mcr-1 was detected in 12.4% (n = 13) of the E. coli isolates, of which six and seven were from calves and piglets, respectively [3,4]. In the present study, we analysed porcine and bovine colistin-resistant Escherichia coli isolates that did not show presence of mcr-1 and identified a novel plasmid-mediated colistin resistance-conferring gene, mcr-2.


Identification of mcr-2 in colistin-resistant E. coli isolates not harbouring mcr-1

Of 92 porcine and bovine colistin-resistant Escherichia coli isolates not harbouring mcr-1, 10 were randomly selected for further analysis. Plasmid DNA was isolated (PureLink HiPure Plasmid Miniprep Kit, Invitrogen, Carlsbad, CA, United States), sequenced by Illumina (2 x 250 bp) (Nextera XT sample preparation kit, MiSeq), de novo assembled and annotated using SPAdes (v3.8.1) and RAST [5,6]. Plasmids from three of the 10 E. coli isolates showed the presence of a gene for a putative membrane protein, which was identified as a phosphoethanolamine transferase (sulfatase) using pfam and Interproscan protein databases [7,8] The mcr-2 gene, as we termed it, is 1,617 bp long, nine bases shorter than mcr-1 (1,626 bp), and shows 76.75% nt identity to mcr-1 (supplementary material [9]).
The entire mcr-2 gene was amplified (PCR primers: MCR2-F 5′ TGGTACAGCCCCTTTATT 3′; MCR2-R 5′ GCTTGAGATTGGGTTATGA 3′), cloned (vector pCR 2.1, TOPO TA Cloning kit, Invitrogen) and electroporated into DH-5 αE. coli. Transformants exhibited colistin MICs of 4–8 mg/L (E-test, bioMerieux, Marcy l’Etoile, France), which were reconfirmed by macrobroth dilution (European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines [2]).

mcr-2 is harboured on IS1595 with likely origins in Moraxella spp.

mcr-2-harbouring plasmids from all three E. coli isolates were analysed. The mobile element harbouring mcr-2 was identified as an IS element of the IS1595 superfamily, which are distinguished by the presence of an ISXO2-like transposase domain [10].
We also identified a 297 bp open reading frame downstream of mcr-2 on this element, which encodes a PAP2 membrane-associated lipid phosphatase with 41% identity to Moraxella osloensis phosphatidic acid phosphatase (71% query coverage). Interestingly, a blastn search of the IS1595 backbone, after removal of the mcr-2 and pap2phosphatase gene sequences, identified a single hit to Moraxella bovoculi strain 58069 (GenBank accession number CP011374) genomic region (1,531,602 to 1,532,255 bp) with 75% identity and 100% query coverage.

mcr-2 is harboured on an IncX4 incompatibility-type plasmid in E. coli ST10

The three mcr-2 plasmid-harbouring E. coli isolates belonged to ST10 (n = 2, porcine) and ST167 (n = 1, bovine). All three plasmids belonged to IncX4 incompatibility type; all three mcr-2 genes showed 100% homology.
Plasmid pKP37-BE isolated from one of the porcine ST10 E. coli isolates was found to have a size of 35,104 bp, 41.3% GC content and 56 protein-encoding gene sequences (RAST) (Figure 1); European Nucleotide Archive accession numbers PRJEB14596 (study) and LT598652 (plasmid sequence).

Apart from IS1595, pKP37-BE did not carry any other resistance genes and the plasmid backbone was highly similar toSalmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_32 (GenBank accession number JX258655), with 98% identity and 90% query coverage. Several Salmonella-associated virulence genes were found on pKP37-BE, including virB/D4 that encodes a type 4 secretion system [11].

Conjugation experiments using a rifampicin-resistant E. coli recipient (A15) showed an approximately 1,200-fold higher transfer frequency of the mcr-2-harbouring pKP37-BE (1.71 × 10−3) compared with the mcr-1 harbouring IncFII plasmid, pKP81-BE (1.39 × 10−6) [4]. Both mcr-1 and mcr-2 transconjugants exhibited colistin MICs of 4–8 mg/L (macrobroth dilution).

Structure predictions and phylogenetic analyses of the MCR-2 protein

MCR-2 protein was predicted to have two domains, with domain 1 (1 to 229 residues) as a transporter and domain 2 (230 to 538 residues) as a transferase domain (Figure 2).

The best template for domain 1 was 4HE8, a secondary membrane transport protein with a role in transferring solutes across membranes [12]. The best-fit template for domain 2 was 4kav (p = 4.13 e-13), a lipooligosaccharide phosphoethanolamine transferase A from Neisseria meningitides, also previously shown to be the best-fit template for MCR-1 [1]. 4kav belongs to the YhjW/YjdB/YijP superfamily and its role in conferring polymyxin resistance has been experimentally validated [13]. Overall, the un-normalised global distance test (uGDT) was 318 (GDT: 58) and all 538 residues were modelled (Figure 2).

MCR-1 and MCR-2 proteins showed 80.65% identity (supplementary material [9]). In addition, MCR-2 showed 64% identity to the phosphoethanolamine transferase of Moraxella osloensis (WP_062333180) with 99% sequence coverage, and 65%, 65%, and 61% identity to that of Enhydrobacter aerosaccus (KND21726), Paenibacillus sophorae(WP_063619495) and Moraxella catarrhalis (WP_003672704), respectively, all with 97% query coverage.
We also carried out blastp searches of the two domains of MCR-2 separately. The identity level of domain 1 between MCR-1 and MCR-2 was low (72%) compared with that for domain 2 (87.4%). Other blastp hits for the domain 2 transferase were Enhydrobacter aerosaccus and Moraxella osloensis (69% identity; 100% query coverage) followed byPaenibacillus sophorae (68% identity; 100% query coverage) and Moraxella catarrhalis (68% identity; 99% query coverage). Phylogenetic analysis showed that MCR-2 might have originated from Moraxella catarrhalis (56% bootstrap value) (Figure 3).

PCR-based screening identified a higher prevalence of mcr-2 than of mcr-1 in porcine E. coliin Belgium

We screened our entire collection of porcine and bovine colistin-resistant E. coli isolates (n = 105) using an mcr-2-specific PCR approach using primers MCR2-IF 5’ TGTTGCTTGTGCCGATTGGA 3’ and MCR2-IR 5’ AGATGGTATTGTTGGTTGCTG 3’, and the following cycling conditions: 33 cycles of 95 °C × 3 min, 65 °C × 30 s, 72 °C × 1 min, followed by 1 cycle of 72 °C × 10 min. We found mcr-2 in 11/53 porcine and 1/52 bovine colistin-resistant E. coliisolates (an overall prevalence of 11.4%).

Discussion

Identification of plasmid-mediated colistin resistance represents a paradigm shift in colistin-resistance mechanisms, which until recently were restricted to chromosomal mutations and vertical transmission. Since mcr-1 conferring plasmid-mediated colistin resistance was first detected in China, mcr-1 has been identified in 32 countries across five continents [14-22] (Figure 4)*.

Figure 4

Countries (n = 32)* reporting presence of mcr-1 in samples of animal, environmental or human origin (data collected till 27 June 2016)
/images/dynamic/articles/22525/16-00435-f4


Adapted from [15]; updated using data from [14,16-22]*.
Our analysis identified a novel plasmid-mediated phosphoethanolamine transferase-encoding gene, mcr-2, which was detected at an even higher prevalence than that of mcr-1 among colistin-resistant porcine E. coli in our study. We were, however, limited by small sample numbers. It should also be noted that the calves and piglets were from different regions of the country (calves from Wallonia and piglets from Flanders).
Phylogenetic analysis of MCR-2 provided strong evidence that this protein was distinct from MCR-1, and that it might have originated from Moraxella catarrhalis. The latter set of data are further strengthened by the fact that mcr-2 is co-harboured with a lipid phosphatase gene that shows highest homology to a phosphatase from Moraxella spp., and that the genetic element IS1595 harbouring these two genes might itself have originated from Moraxella spp. WhileMoraxella spp. are not polymyxin producers, this bacterial genus is known to be intrinsically resistant to polymyxins [23] and potential intergeneric transfer of mcr-2 from co-habiting Moraxella spp. of animal, human or environmental origin is therefore highly likely. Phosphoethanolamine transferases are housekeeping enzymes that catalyse the addition of the phosphoethanolamine moiety to the outer 3-deoxy-D-manno-octulosonic acid (Kdo) residue of a Kdo(2)-lipid A [24]. The fact that we did not identify any chromosomal mutations in the known colistin resistance-conferring genes in our E. coliisolates (by whole genome sequencing, data not shown) additionally supports the role of the acquired phosphoethanolamine transferase in conferring colistin resistance.
Finally, the high transfer frequency of the mcr-2-harbouring IncX4 plasmid might underlie the higher prevalence of mcr-2in our porcine isolates. In the three mcr-2 harbouring isolates analysed, IS1595 showed presence of direct repeats and a complete tnpA gene, while inverted repeats were not found (data not shown). However, the carrier plasmid IncX4 is itself highly transmissible, showing 102–105-fold higher transfer frequencies than, for instance, epidemic IncFII plasmids, as shown previously [25] as well as in our own transconjugation experiments. Importantly, a lack of fitness-burden of IncX4 carriage on bacterial hosts [25] makes this plasmid replicon a highly effective vehicle for dissemination of mcr-2. IncX4 plasmids have also been previously shown to harbour mcr-1 [26] as well as extended spectrum beta-lactamase genes, blaCTX-M [25]. Interestingly, the pKP37-BE backbone, which likely originated from Salmonella spp., harboured a battery of virulence genes including the virB4/D4 genes encoding a type-IV secretion system that has been shown to mediate downregulation of host innate immune response genes and an increased bacterial uptake and survival within macrophages and epithelial cells [11]. Outer membrane modifications leading to colistin resistance have been shown to attenuate virulence [27]: whether these co-harboured virulence genes are able to compensate the pathogenic abilities of colistin-resistant E. coli remains to be explored.
Taken together, these data call for immediate inclusion of mcr-2 screening in ongoing molecular epidemiological surveillance to gauge the worldwide dissemination of mcr-2 in both human and animal colistin-resistant Gram-negative bacteria of medical importance.
Source: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=22525

Thursday, October 10, 2013






Massive breakthrough: Scientists create first new antibiotic in nearly 30 years

LONDON: In a massive breakthrough, scientists have created the first new antibiotic in more than three decades, Teixobactin, that can treat many common bacterial infections such as tuberculosis, septicemia and C Diff or clostridium difficile colitis. 

The discovery comes at a time when World Health Organization has sent out warnings that humanity is staring at a post-antibiotic era when common infections will no longer have a cure. The first antibiotic, Penicillin, was discovered by Alexander Fleming in 1928, and more than 100 compounds have been found since then, but no new class has been found since 1987. 

Antibiotics have been magic bullets for human health for decades but irrational use has made most bugs resistant to these. Northeastern University's professor Kim Lewis announced Thursday the discovery of the antibiotic that eliminates pathogens without encountering any detectable resistance. 

Lewis and Northeastern biology professor Slava Epstein co​authored the finding with colleagues from the University of Bonn in Germany, Novo Biotic Pharmaceuticals in Cambridge, Massachusetts, and Selcia Ltd in the United Kingdom. 

Most antibiotics target bacterial proteins, but bugs can become resistant by evolving new kinds of proteins. What's unique about Teixobactin is that it launches a double attack on the building blocks of bacterial cell walls. Experts say this will pave the way for a new generation of antibiotics because of the way it was discovered. 

Teixobactin could be available in the next five years. Its testing on mice has shown it clears infections without side-effects. The NU team led by Prof Lewis is now concentrating on upscaling production of Teixobactin to test it on humans. 

Northeastern researchers' pioneering work to develop a novel method for growing uncultured bacteria led to the discovery of the antibiotic, and Lewis's lab played a key role in analyzing and testing the compound for resistance from pathogens. 

Lewis said this marks the first discovery of an antibiotic to which resistance by mutations of pathogens have not been identified. 

"So far, the strategy has been based on developing new antibiotics faster than the pathogens acquire resistance. Teixobactin presents a new opportunity to develop compounds that are essentially free of resistance," Lewis said. 

The screening of soil micro-organisms has produced most antibiotics, but only one per cent of these will grow in the lab, Lewis explained. He and Epstein spent years seeking to address this problem by tapping into a new source of antibiotics beyond those created by synthetic means: uncultured bacteria, which make up 99% of all species in external environments. 

They developed a novel method for growing uncultured bacteria in their natural environment. Their approach involves the iChip, a miniature device Epstein's team created that can isolate and help grow single cells in their natural environment and provide researchers with much improved access to uncultured bacteria. 

"Novo Biotic has assembled about 50,000 strains of uncultured bacteria and discovered 25 new antibiotics, of which Teixobactin is the latest and most interesting," Lewis said. 

"Our impression is that nature produced a compound that evolved to be free of resistance," Lewis said. "This challenges the dogma that we've operated under that bacteria will always develop resistance. Well, maybe not in this case." 

Britain's chief medical officer, Dame Sally Davies, recently said antibiotic resistant was "as big a risk as terrorism", and warned that Britain faced returning to 19th century scourges when the smallest infection or operations could kill. 

WHO said a comprehensive study of antibiotic development, covering innovative, small firms, as well as pharmaceutical giants found that only 15 out of 167 antibiotics under development had a new mechanism of action with the potential to meet the challenge of multidrug resistance. 
Reff:http://timesofindia.indiatimes.com/home/science/Massive-breakthrough-Scientists-create-first-new-antibiotic-in-nearly-30-years/articleshow/45807598.cms

 
We are cordially inviting you to participate in our knowledge carnival graVITas'14 at 
VIT University, Vellore, TN, India. Click us http://vitgravitas.com/  
 www.vit.ac.in
-----------------------------------------------------------------------------------------------------------------------------
Superbugs threaten a return to the ‘dark ages’







Britain will lead the fightback against antibiotic-resistant superbugs threatening to send medicine "back into the dark ages", David Cameron has said.





The Prime Minister said resistance to antibiotics was a "very real and worrying threat" and could lead to a future in which currently treatable injuries and ailments could prove fatal.





As part of the effort to address the issue an international group of experts will aim to stimulate the development of a "new generation of antibiotics", The Times reported.
"This is not some distant threat but something happening right now," Mr Cameron told the newspaper. "If we fail we are looking at an almost unthinkable scenario where antibiotics no longer work and we are cast back into the dark ages of medicine where treatable infections and injuries will kill once again.
"That simply cannot be allowed to happen and I want to see a stronger, more coherent global response."
Former Goldman Sachs chief economist Jim O'Neill will lead the international expert group and has been asked to consider how governments would pay pharmaceutical companies to produce drugs even if they were rarely used.
The group will also consider how poorer countries can be encouraged to improve control of existing antibiotics.
The Prime Minister told The Times: " I've been listening to the scientific advice that I get, and the network of advisers we have are all saying this is one of the most serious health problems the world faces.
"For many of us we only know a world where infections or sicknesses can be quickly remedied by a visit to the doctor and a course of antibiotics.
"This great British discovery has kept our families safe for decades, while saving billions of lives around the world.
"But that protection is at risk as never before. Resistance to antibiotics is now a very real and worrying threat."
He added: "When we've had these problems in the past, whether it is how we tackle HIV and Aids, how it is possible to lead the world and get rid of diseases like polio, Britain has taken a lead and I think it is right we take a lead again."
The Prime Minister raised the issue privately with US president Barack Obama and German chancellor Angela Merkel during the G7 summit last month.
The initial £500,000 cost of the work will be met by the Wellcome Trust, whose director Jeremy Farrar said: "Drug-resistant bacteria, viruses and parasites are driving a global health crisis.
"It threatens not only our ability to treat deadly infections, but almost every aspect of modern medicine: from cancer treatment to Caesarean sections, therapies that save thousands of lives every day rely on antibiotics that could soon be lost.
"We are failing to contain the rise of resistance, and failing to develop new drugs to replace those that no longer work. We are heading for a post-antibiotic age.
"This is not just a scientific and medical challenge, but an economic and social one too. I am thus delighted that an economist of the stature of Jim O'Neill has agreed to investigate these issues, with an eye on the incentives, regulatory systems and behavioural changes that will be required to resolve them.
"The Wellcome Trust is proud to fund and host Jim and his team as they conduct this vital work.
"Drug-resistant infection is one of the most urgent challenges of our time. It demands the attention of world leaders and international action, which is why it is encouraging that David Cameron is taking the issue so seriously and giving it the profile it deserves."
Professor Dame Sally Davies, the chief medical officer for England, said: "We must act now on a global scale to slow down antimicrobial resistance.
"In Europe, at least 25,000 people a year already die from infections which are resistant to our drugs of last resort. New antibiotics made by the biotech and pharmaceutical industry will be central to resolving this crisis which will impact on all areas of modern medicine.
"I am delighted to see the Prime Minister taking a global lead by commissioning this review to help new antibiotics to be developed and brought to patients effectively."

Antibiotic resistance: Cameron warns of medical 'dark ages'


The world could soon be "cast back into the dark ages of medicine" unless action is taken to tackle the growing threat of resistance to antibiotics, Prime Minister David Cameron has said.
He has announced a review into why so few anti-microbial drugs have been introduced in recent years.
Economist Jim O'Neill will lead a panel including experts from science, finance, industry, and global health.
It will set out plans for encouraging the development of new antibiotics.
'Taking the lead' The prime minister said: "If we fail to act, we are looking at an almost unthinkable scenario where antibiotics no longer work and we are cast back into the dark ages of medicine where treatable infections and injuries will kill once again."
Mr Cameron said he discussed the issue at a G7 leaders meeting in Brussels earlier this month and got specific support from US President Barack Obama and German Chancellor Angela Merkel.
It is hoped that the review panel's proposals will be discussed at next year's G7 summit, which will be hosted by Germany.
"Penicillin was a great British invention by Alexander Fleming back in 1928," Mr Cameron told the BBC. "It's good that Britain is taking the lead on this issue to solve what could otherwise be a really serious global health problem."
He said the panel would analyse three key issues: the increase in drug-resistant strains of bacteria, the "market failure" which has seen no new classes of antibiotics for more than 25 years, and the over-use of antibiotics globally.
'Time bomb' It is estimated that drug-resistant strains of bacteria are responsible for 5,000 deaths a year in the UK and 25,000 deaths a year in Europe.
bacteria A resistant strain of bacteria
Chief Medical Officer for England Prof Dame Sally Davies has been a key figure helping to get the issue on the government and global agenda.
Last year she described the threat of antimicrobial resistance as a "ticking time bomb" and said the dangers it posed should be ranked along with terrorism.
She spoke at a meeting of scientists at the Royal Society last month which warned that a response was needed akin to efforts to combat climate change.
Dame Sally said: "I am delighted to see the prime minister taking a global lead by commissioning this review.
"New antibiotics made by the biotech and pharmaceutical industry will be central to resolving this crisis which will impact on all areas of modern medicine."
Antibiotics dates of discovery timeline
Medical research charity the Wellcome Trust is providing £500,000 of funding for Mr O'Neill and his team, which will be based at their headquarters in central London.
Antimicrobial resistance has been a key issue for Jeremy Farrar, since he became director of the Wellcome Trust last year.
"Drug-resistant bacteria, viruses and parasites are driving a global health crisis," he said.
"It threatens not only our ability to treat deadly infections, but almost every aspect of modern medicine: from cancer treatment to Caesarean sections, therapies that save thousands of lives every day rely on antibiotics that could soon be lost."
'Market failure' Antibiotics have been an incredible success story, but bacteria eventually develop resistance through mutation.
One example is MRSA, which has been a major threat for years in hospitals. It is resistant to all but the most powerful of antibiotics, and the main weapon against it is improved hygiene, which cuts the opportunity for infection to spread.
Without antibiotics a whole raft of surgical procedures would be imperilled, from hip replacements to cancer chemotherapy and organ transplants.
Before antibiotics, many women died after childbirth after developing a simple bacterial infection.
Mr O'Neill is a high-profile economist who is best-known for coining the terms Bric and Mint - acronyms to describe countries which are emerging and potential powerhouses of the world economy.
He is not, though an expert on antibiotics or microbes. But Mr Cameron told the BBC it was important to have an economist heading the review:
"There is a market failure; the pharmaceutical industry hasn't been developing new classes of antibiotics, so we need to create incentives."
Jeremy Farrar said: "This is not just a scientific and medical challenge, but an economic and social one too which would require analysis of regulatory systems and behavioural changes to solve them."
Mr O'Neill will begin work in September and is expected to deliver his recommendations next spring.
Last month antibiotic resistance was selected as the focus for the £10m Longitude Prize, set up to tackle a major challenge of our time.

 http://www.guardian-series.co.uk/uk_national_news/11313176.UK_to_lead_superbug_fight___Cameron/

Reff: The Times of London-Twitter, http://www.bbc.com/news/health-28098838
------------------------------------------------------------------------------------------------------------------------------





How a Microbe Resists Its Own Antibiotics

Researchers reveal the molecular mechanisms of Streptomyces platensis’s defense from its own antibiotics, which inhibit fatty acid synthesis in other microbes.
By | February 20, 2014
  • Slide culture of a Streptomyces species WIKIMEDIA, CDC PUBLIC HEALTH IMAGE LIBRARYIn the mid-2000s, scientists identified two novel antimicrobial compounds in the bacterium Streptomyces platensis, each of which target a different enzyme involved in fatty acid synthesis in other microbes. Platensimycin and platencin are now being explored as a new class of antibiotics. Research published today (February 20) in Chemistry & Biology from investigators at the University of Wisconsin-Madison and The Scripps Research Institute in Jupiter, Florida, details the mechanism by which S. platensis protects itself from its own antibiotics: the bacterium employs an enzyme during fatty acid synthesis that is unaffected by the compounds.
“It is a nice piece of work and is perhaps one of the first complete demonstrations of antibiotic resistance mechanisms from genome sequencing information,” microbiologist Julian Davies, a professor emeritus at the University of British Columbia who was not involved in the work, told The Scientist in an e-mail.
“The novelty is in the detail here,” agreed David Hopwood, former head of the genetics department and now emeritus fellow at the John Innes Centre, who also did not participate in the research. “It tells us a lot of interesting things about fatty acid biosynthesis in bacteria . . . [and] about the way that the antibiotics interact with [that] pathway.”
Since researchers first identified platensimycin and platencin, they have questioned how the compounds do not disrupt the synthesis of S. platensis’s own fatty acids. “If the organism is making an antibiotic which is potentially lethal, it has to protect itself,” Hopwood said. “So almost always an antibiotic producer has self-protecting mechanisms.”
To identify those mechanisms, Scripps microbiologist Ben Shen and his colleagues performed bioinformatics analyses of the open reading frames in the genomes of two strains of S. platensis and identified four genes that, based on their homology to enzymes of known function and their apparent lack of a role in antibiotic biosynthesis, the researchers hypothesized may confer resistance to platensimycin and platencin. Follow-up experiments revealed that the enzyme PtmP3, which is resistant to the antibiotics, had replaced two fatty acid biosynthesis enzymes, FabF and FabH, which are normally inhibited by the compounds, and expression of PtmP3 in the normally susceptible S. albus rendered the bacteria resistant to both antibiotics. Moreover, S. platensis’s FabF had evolved structural changes so as to be resistant to platensimycin, serving as “a second form of self-resistance,” the authors wrote.
Similar self-resistance mechanisms were previously identified in other bacteria—for example, in Pantoea agglomerans, which produces the antimicrobial compound andrimid. “The way the producing bacterium copes with this dilemma is to make its own enzyme resistant to the inhibitor,” microbiologist and biochemist John Cronan at the University of Illinois at Urbana-Champaign, who was not involved in the work, wrote in an e-mail. “[T]his is essentially the same message that the Shen paper reports.”
Whether the findings could inform platensimycin and platencin development efforts remains to be seen, however. “[B]oth compounds have poor pharmacokinetics,” Cronan noted. “They have too high a rate of clearance in the body and gram negative bacteria are resistant due to efflux pumps. . . . As far as the future of these compounds my guess is that they will fail (or have already failed).”
Nevertheless, Shen and his colleagues are hopeful that understanding how S. platensis protects itself will yield insight that could aid the development of platensimycin and platencin.
“Development of resistance in pathogenic bacteria has widely been attributed to horizontal gene transfer from nonpathogenic bacteria with one potential source being antibiotic-producing bacteria that developed highly effective mechanisms to avoid suicide,” the authors wrote in their paper. “Understanding self-resistance mechanisms within [platensimycin] and [platencin] producing organisms therefore is imperative for predicting, determining, and thereby managing, potential resistance that could develop with any future use of [these drugs] or their derivatives in the clinic.”
R.M. Peterson et al., “Mechanisms of self-resistance in the platensimycin and platencin producing Streptomyces platensis MA7327 and MA7339 strains,” Chemistry & Biology,  2014.

 Reff.:The.Scientist.com

------------------------------------------------------------------------------------

Early Evidence

Fossilized structures suggest that mat-forming microbes have been around for almost 3.5 billion years.
By | March 1, 2014
OLD MICROBES: These chips in the rocks of Western Australia’s Dresser Formation are thought to have been made by ancient microbial mats.COURTESY NORA NOFFKE

EDITOR'S CHOICE IN EVOLUTION/GEOBIOLOGY

The paper
N. Noffke et al., “Microbially induced sedimentary structures recording an ancient ecosystem in the ca. 3.48 billion-year-old Dresser Formation, Pilbara, Western Australia,” Astrobiology, 13:1103-24, 2013.

The background
Modern microorganisms leave traces on substrates called microbially induced sedimentary structures (MISS)—textures that arise from a biofilm or microbial mat interacting with the dynamics of the sediments upon which it forms. Until recently, the oldest fossilized MISS, located in South Africa, dated back to 3.2 billion years ago. However, evidence from microfossils and stromatolites, another rock structure shaped by bacteria, suggests that microbes existed at least 200 million years earlier.

The evidence
In the Dresser Formation in Western Australia—one of the only places in the world with well-preserved 3.48-billion-year-old rocks—Nora Noffke of Old Dominion University in Norfolk, Virginia, and colleagues recorded microtextures characteristic of biofilms and microbial mats and uncovered geochemical signals consistent with a biological origin. The morphology and distribution of the fossils in this ancient coastal salt flat strongly resembled modern MISS.

The significance
The finding “supports interpretations that life had evolved before 3.4 billion years [ago], as indicated by the presence of both stromatolites and microfossils,” Kath Grey, who is the former chief paleontologist of the Geological Survey of Western Australia and was not involved in the research, wrote in an e-mail to The Scientist. According to Noffke, the fossilized MISS’s similarities to contemporary MISS suggest that ancient biofilms behaved in the same way that modern microbes do.

The origins
The Mars rover is currently hunting for MISS as a sign of life. Here on Earth, the origin of life predates the fossils from the Dresser Formation. Even 3.5 billion years ago, “life is already so complex,” Noffke says. “Its evolution must have taken a lot of time.”
Reff: The.Scientist.com

------------------------------------------------------------------------------------

Outwitting the Perfect Pathogen

 
WORLDWIDE PATHOGEN: About one-third of the human population is infected with Mycobacterium tuberculosis (cultures shown above), some 13 million of which are actually sick with TB.CDC/GEORGE KUBICA
In 2009, an international consortium of researchers initiated an efficacy trial for a new tuberculosis (TB) vaccine—the first in more than 80 years. With high hopes, a team led by the South African Tuberculosis Vaccine Initiative inoculated 2,797 infants in the country, half with a vaccine called MVA85A and half with a placebo. They followed the children for up to three years and finally announced the result last February. It was not good news (Lancet, 381:1021-28, 2013).
“It did not work,” says Thomas Evans, president and CEO of Aeras, the Rockville, Maryland-based nonprofit that sponsored the trial. The vaccine did not protect children against the deadly disease.
“The whole field was disappointed,” says Robert Ryall, TB vaccine project leader at Sanofi Pasteur, who was not involved in the trial. “And unfortunately the field did not learn much.” The vaccine developers still do not know why MVA85A didn’t work.
The only vaccine currently available in the fight against TB is Bacille Calmette-Guérin (BCG), a live vaccine first used in 1921 and originally derived from a cow tuberculosis strain. Though the exact mechanism of the vaccine’s protection remains unclear, researchers do know that it doesn’t work well: it reduces the risk of a form of TB that is especially lethal to infants, but it does not reliably protect against TB lung infections, which kill more than a million adults worldwide each year.
With every cough or sneeze of an infected individual, TB bacilli fly through the air, and to date have spread to one-third of the world’s population. In most individuals, Mycobacterium tuberculosis (Mtb) lie dormant, never causing sickness. In others, however, the bacteria cause life-threatening lung infections. Some 13 million people around the world are actively sick with TB, and someone dies of the disease approximately every 20 seconds, according to the World Health Organization (WHO).
“The need for a TB vaccine is enormous,” says David Sherman, a tuberculosis expert at the nonprofit Seattle Biomedical Research Institute. And an inadequate vaccine is not the field’s only problem: the four main drugs currently used to treat tuberculosis are also decades old, take six months to rid the body of the bacilli, and are becoming obsolete due to the spread of multidrug-resistant and extensively drug-resistant TB. Despite the gloomy outlook, many researchers are still plugging away, through pharmaceutical-nonprofit partnerships and redesigned basic research efforts, to achieve a happy ending.

Ancient foe

BATTLING TB: Paula Fujiwara (left) of the International Union Against Tuberculosis and Lung Disease speaks with a woman who is serving as the treatment supervisor of her 25-month-old child with TB.WHO/TBP/GARY HAMPTONTuberculosis has plagued humans for thousands of years. Even ancient Egyptians were ravaged by TB, as evidence from mummies has shown. And over those millennia, Mtb has learned to quietly, carefully live within the human body.
“It’s not just a pathogen; in some ways it’s commensal,” says Evans. “It’s been dealing with the human immune system for a long period of time and knows how to go latent and keep itself transmitted.” Of the roughly 2 billion people infected with Mtb, about 90 percent will never get sick, though they are a vast reservoir of the bacteria, fueling the epidemic. And when illness occurs, unlike many infections that involve an acute sickness as the host’s immune system battles the pathogen, tuberculosis infection resembles a chronic disease. “Everything about the infection is slowed down, frankly, in ways we don’t understand,” says Sherman.
E. coli, for example, replicates so quickly—about once every 20 minutes—that one cell can grow into a colony of a million overnight. Mtb, on the other hand, only doubles once every 20 hours, and would take three weeks to grow a colony of similar size. Additionally, the human immune system produces antibodies against most pathogens in roughly 5 to 7 days. Antibody production against Mtb takes three weeks, likely because the bacteria are slow to travel to the lymph nodes where an adaptive immune response commences. “TB is exquisitely adapted to long-term survival in a human host,” says Sherman.
The current TB drug regimen relies on a six-month treatment of four antibiotics, all discovered in the 1950s and ’60s and which primarily inhibit cell-wall and RNA synthesis. (See illustration.) Worldwide, about 3.6 percent of new TB cases and 20 percent of recurring infections are multidrug resistant, according to the WHO.
Mtb is not just a pathogen; in some ways it’s commensal.
—­Thomas Evans, Aeras
Unfortunately, there isn’t a deep pipeline of drug candidates to fall back on. It wasn’t until December 2012, some 50 years after the last first-in-class approvals, that the US Food and Drug Administration approved a TB drug with a new mechanism of action. Janssen Therapeutics’ bedaquiline (Sirturo) inhibits an ATP synthase enzyme in the bacterium’s cell membrane to prevent the pathogen from generating energy and replicating. (See illustration.) No other anti-TB drugs are close to approval.
TB drug development has been slow for several reasons. For one, the drugs are difficult and expensive to make, and they are primarily needed in developing countries that can’t afford to pay top dollar for a six-month drug regimen. “Working in TB will not drive profit for pharmaceutical companies,” says Manos Perros, head of AstraZeneca’s Boston-based Infection Innovative Medicines Unit. As a result, most recent TB drug development has involved collaborations between big pharma and government institutions or nonprofit advocacy organizations, as well as academia. These are “partnerships that bring resources and funding that make this kind of work, frankly, possible,” says Perros. “This is a space where competitions between pharma and academia are unfruitful.”
Other pharma companies share that sentiment. In February 2013, Glaxo-SmithKline (GSK) opened up the closely guarded doors of their laboratories to share information with the TB research community about 177 compounds from the company’s pharmaceutical library that appear to inhibit Mtb (ChemMedChem, 8:313-21, 2013). The set of compounds has already been sent to nine groups in the U.K., U.S., Canada, The Netherlands, France, Australia, Argentina, and India, according to GSK spokesperson Melinda Stubbee.
But even with this collaborative attitude, the research community has struggled to develop successful new TB drugs, in part because the bacterium hides latent inside cells such as macrophages, and unpredictably becomes active in different sites in the lung. “TB drug development is extremely challenging because a drug has to kill not only the replicating but the nonreplicating bacteria,” says Feng Wang of the California Institute for Biomedical Research in La Jolla. To tackle this problem, Wang, along with Peter Schultz at Scripps Research Institute, also in La Jolla, and William Jacobs at Albert Einstein College of Medicine in New York, used a novel screening method to test the effect of 70,000 compounds on a biofilm of Mtb that simulates the latent version of the bacterium. One compound popped out of the screen: TCA1 killed both replicating and nonreplicating Mtb (PNAS, 110:E2510-17, 2013). It appeared to attack on two fronts: preventing bacterial cell-wall synthesis and inhibiting a bacterial enzyme involved in cofactor biosynthesis, which is likely what makes it effective against nonreplicating Mtb. (See illustration.) The compound has since proven successful in both acute and chronic animal models of TB, and the team is tweaking the chemistry to try and make it even more potent, says Wang.
Pharmaceutical company AstraZeneca is similarly developing a drug that is active against latent bacteria. AZD5847, a type of antibiotic called an oxazolidinone that is typically used to treat staph infections, is able to reach and kill Mtb lodging inside macrophages. The company is currently testing the drug in a Phase 2 efficacy trial in South Africa involving 75 patients. But developing the compound wasn’t easy, notes Perros. “We’ve been investing for a decade. It really takes a long time.”

Seeking a boost

THWARTING TB: The traditional regimen for TB includes four antibiotics that primarily inhibit cell-wall synthesis and RNA synthesis. Now, researchers are looking for new ways to stop the bacterium.
See full infographic: JPG | PDF
CDC/RAY BUTLER; ILLUSTRATION BY THE SCIENTIST STAFF; BASED ON NIAID/WIKIMEDIA COMMONS
But even if quick-acting, potent drugs were available, Mtb is so abundant and so well adapted to the human population that the only true path to eradication is not treatment, but prevention. “There’s no endgame without a vaccine,” says Aeras’s Evans. “No matter how much we think we should work on drugs or diagnostics, if we’re not working on vaccines, we’ll never get to our final goal.”
The failure of the MVA85A vaccine trial in South Africa last year was disappointing, but at least a dozen other TB vaccine candidates continue in clinical trials. Most of these reflect one of two general strategies for preventing tuberculosis: improve the existing BCG vaccine or, more commonly, boost its effect with a secondary vaccine. BCG, which is given to infants, primes the immune response early in life, so booster vaccines are usually designed to protect adolescents and adults from later infection. The MVA85A vaccine, for example, was a modified viral vector expressing Mtb antigen 85A designed as a booster to BCG.
Vaccine development, however, is hindered by lack of cellular or molecular markers that directly correlate with immune protection from TB, making it difficult to predict how well a vaccine might protect against TB based on the responses of a handful of individuals. “The only tool we have to make sure a vaccine works is a very large, very expensive field trial,” says Evans. And that high price tag, as in TB drug development, has turned numerous pharmaceutical companies off the pursuit of a TB vaccine.
But with financial and research support from nonprofit partners like Aeras—funded by the Bill & Melinda Gates Foundation, among others—a few companies are still in the game. In collaboration with Aeras, Sanofi Pasteur is developing a BCG booster vaccine that began Phase 1/2a safety trials in South Africa last July. It is a recombinant vaccine made up of two TB proteins fused together and coupled with an adjuvant called IC31, which really “drives the immune response,” says Sanofi’s Ryall. Aeras also has another big-pharma partnership with GSK on a vaccine called M72/AS01e, which has been in Phase 1 and 2 clinical trials since 2004, including an ongoing trial in Taiwan and Estonia. The vaccine combines a GSK recombinant antigen called M72, derived from two tuberculosis-expressed proteins, and a GSK adjuvant called AS01e.

Fresh start

BLASTING TB: An Aeras employee works on the spray dryer, which creates TB vaccines in a powder form that can be delivered directly to the lungs.AERASWith TB drugs and vaccines still in early clinical phases, some scientists are going back to the basics to see if a better molecular understanding of the bacterium itself could assist these programs. “We need to develop vaccines, and we need to develop products, but as we do, it’s very clear that we need to be learning a lot more about the immunobiology [of TB],” says Evans.
Last July, for example, Sherman and colleagues published the first large-scale map of the bacterium’s regulatory and metabolic networks (Nature, 499:178-83, 2013). The team initially plotted the relationships of 50 Mtb transcription factors, and later, all 200, which control the expression of the rest of the bacterium’s genes. “Our hope is that by looking at it in this different way, we can describe different kinds of drug targets than we have ever done before,” says Sherman.
The team found that Mtb is remarkably well networked, so that if a mutation or drug stymies one gene or protein, others step in as backups, allowing the bacterium to continue functioning normally. But targeting transcription factors that control whole networks could shut down an entire system, backups and all. One such network already looks like a promising drug target—transcription factors controlling a group of proteins in the bacterium’s cell membrane that pump antibiotics and other drugs out of the cell. Mtb has so many such pumps that it is extremely difficult to target multiple pumps for treatment, but genes that activate numerous pumps at the same time are a far more promising drug target.
The idea that scientists will soon develop new, better TB drugs and vaccines “helps get me up in the morning,” says Sherman. It’s going to take more breakthroughs than are on the immediate horizon, he adds, “but if we keep at it, we will get there.”



Reff:http://www.the-scientist.com/?articles.view/articleNo/38708/title/Outwitting-the-Perfect-Pathogen/